A new method called Transfer PCR (TPCR) which combines PCR amplification of a gene present in a vector / plasmid and subsequent integration of the PCR product into the recipient vector without intermediate product purification and without the need of any commercial kit has been discovered by Researchers from Hebrew University of Jerusalem,and Weizmann Institute of Science, Israel.
For DNA cloning, the donor and the recipient plasmids are present in the same reaction tube together with the other reaction components, including primers, reaction buffer and dNTPs. The two primers include sequences, which are complimentary to the target gene at the 3′ end and sequences corresponding to the integration site in the recipient vector at the 5′ end.
{Image courtesy: Journal of Structural Biology)
Example:
The transcription factor IIE α subunit (ΤFIIEα, ∼1300 bp) gene is in
pET28-TFIIEα vector (the donor plasmid) and has to be cloned into the expression vector pACYCDuet-1. The primers ranging in size from 50–52 bp were used for amplification of the two genes and included an optimal 30 bp overlapping region with the site of integration into the recipient vectors (highlited in yellow)
CATCACCATCATCACCACAGCCAGGATCCGGCAGACCCAGATGTCCTCAC
TCGACTTAAGCATTATGCGGCCGCAAGCTTTCACTCAAAGAGGTCCTCAAAC
Following the initial stage of PCR amplification the generated intermediate PCR product serves as a mega-primer for incorporation into the recipient vector in a linear amplification. The PCR product on the other hand, cannot serve as a mega-primer for incorporation into the donor plasmid since it lacks complementarity at the 3′ ends. At the final stage, the donor plasmid is digested by DpnI to remove the methylated parental plasmid. The reaction mixture is then transformed into E. coli cells to obtain the newly formed recombinant plasmid. This method also has been successfully used for generating point mutations.
[Click here to read the original article published in Journal of Structural Biology]
0 comments:
Post a Comment